Inicio » Foro » Foro de Perros » Foro de Otros temas
  < 1 2 3 4 ...>
  • ukyo

    Agregar como amigo

    Registrado: 04/01/2011
    Posts: 2014

    #0

    15/05/2012, 23:04

    GENÉTICA: EMPEZANDO POR EL PRINCIPIO

    En este tema iré escribiendo pequeños artículos de genética básica, para el que esté interesado. Seguramente escriba más de uno, por lo que os recomiendo que no leáis exclusivamente el primer post del tema si acaba teniendo muchas hojas, y que busquéis si hay más información en el futuro.

    El texto es de mi puño y letra a no ser que especifique lo contrario. Las imágenes son todas de Internet.

    --------------------------------------------------------


    LOS GENES NO CODIFICAN CARACTERES, CODIFICAN PROTEÍNAS.

    ¿Por qué es importante entender esto?

    Mucha gente tiene la tendencia a pensar que un gen da lugar de forma invariable a un carácter. Es decir, que existe un gen de los ojos azules, un gen del pelo rubio, un gen de los brazos largos, un gen de la piel oscura… etc.

    Esto es absoluta y totalmente erróneo, y deriva del escasísimo conocimiento genético que tiene la población de hoy en día, cuyos conocimientos se derivan de la genética mendeliana donde se vieron estos sucesos. Los experimentos de Mendel explican la parte más sencilla de la genética, pero se quedan cortos (cortísimos) para hablar de temas más serios, como las enfermedades hereditarias de los perros, por ejemplo.

    Por eso es importante que quede BIEN CLARO que los genes NO DAN LUGAR a caracteres concretos, sino a proteínas. Y es la interacción de las proteínas entre ellas (o la carencia de esta interacción, en algunos casos) lo que da lugar a la mayoría de los caracteres genéticos.

    Para el que ande pez, un carácter es cualquier cosa que os queráis proponer. Desde el color de ojos, pasando por la altura de una persona, hasta la longitud del hueso de la mandíbula inferior o el color de la planta del pie. Todo eso está determinado, en parte por su BACKGROUND genético y en parte de forma ambiental (es decir, por el desarrollo embrionario, entre otros).



    Entonces, ¿qué es un gen molecularmente hablando?

    Una mirada hacia atrás: el DNA, ese gran desconocido.

    Si atendemos al DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR, propuesto por Watson y Crick a raíz de su descubrimiento de la estructura molecular del DNA (estudios por los que obtendrían el premio Nobel) se propone un flujo unidireccional de la información genética (que hoy día se ha demostrado que tiene excepciones pero que nos sirve para lo que queremos explicar).

    La información genética de un individuo está "guardada" en su DNA. El DNA es simplemente una molécula en forma de doble hélice formada por unidades que se emparejan con la otra hebra de manera concreta. Tenemos 4 unidades (nucleótidos) distintos, Adenina (A), Guanina (G), Citosina (C) y Timina (T). Adenina siempre empareja con Timina a través de dos puentes de hidrógeno (un tipo de enlace químico) y Citosina lo hace con Guanina a través de tres puentes de hidrógeno. Gracias a esto se forma una estructura de doble hélice levógira (que gira a izquierdas) en la que se concentra toda la información genética de un individuo.



    ¿Cómo es eso posible?

    Es sencillo, y es la base del DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR. La información contenida en el DNA está en forma de CÓDIGO, de modo que cada una de las dos hebras que forman la molécula de DNA tiene un código "de letras" formado por sus nucleótidos. Por ejemplo, el código de una hebra de DNA puede ser:

    AAAGCGAGTAGTGGCCATGAC

    Los sistemas celulares saben interpretar este código y producir otras moléculas a partir de él, así es que a partir del DNA por un proceso que se conoce como TRANSCRIPCIÓN, y a través de unas enzimas (proteínas catalíticas) concretas obtenemos los distintos tipos de RNA (ribosómico, de transferencia y mensajero).


    ¿Interpretamos el código? Fabricando proteínas.

    Dejaremos de lado dos de los tipos de RNA y nos interesaremos por el RNA mensajero, pues es el que principalmente dará lugar a las proteínas de los organismos.

    Así es que a través del proceso de TRANSCRIPCIÓN el ejemplo de código anterior puede TRANSCRIBIRSE a RNA. El RNA se diferencia del DNA básicamente en un sustituyente (una ramificación) de la ribosa que forma el nucleótido y en que no existe el nucleótido Timina, en su lugar existe el Uracilo (U), que empareja con la Adenina igual que la Timina (con dos puentes de hidrógeno). Así si nosotros fuéramos una enzima (concretamente, una RNA polimerasa), TRANSCRIBIRÍAMOS el código de la hebra anterior a RNA mensajero así:

    UUUCGCUCACCGGUACUG

    Simplemente:
    Donde hay A ponemos U (pues la adenina empareja con uracilo).
    Donde hay T ponemos A (pues la timina empareja con la adenina).
    Donde hay G ponemos C (pues la guanina empareja con la citosina).
    Donde hay C ponemos G (pues la citosina empareja con la guanina).



    En la imagen se esquematiza el proceso de la transcripción. Las líneas azules representan las dos cadenas del DNA, que se mantienen superenrrolladas en condiciones normales. Durante la transcripción, mediante otras enzimas y un proceso molecular complejo se libera la tensión en la zona de interés (donde está el gen que queremos transcribir) para garantizar el acceso de la RNA polimerasa (pelota azul). La línea naranja representa el RNA mensajero que la RNA polimerasa se está encargando de generar. Como se puede observar, sólo una cadena del DNA se utiliza para la transcripción (cadena molde), la otra no se utiliza (cadena inactiva). El uso de una u otra, y en una dirección u otra dependerá de qué gen (o genes) esté la célula interesada en transcribir.

    Continuemos, ya tenemos el RNA mensajero… ¿De dónde sacamos la proteína?

    El proceso molecular de transmisión de la información génica no concluye con la transcripción, el RNA mensajero tiene que ser leído por la maquinaria celular para producir otras moléculas: las PROTEÍNAS. Este proceso se denomina TRADUCCIÓN, y se efectúa a través de la actuación de la maquinaria ribosomal de la célula (es decir, de los orgánulos celulares conocidos como “ribosomas”).



    La imagen muestra la estructura de un ribosoma. Está formado por dos subunidades que se conocen como “subunidad grande” y “subunidad pequeña”. Durante el proceso de traducción el ribosoma “lee” la hebra de RNA mensajero formada durante la traducción y construye una cadena peptídico a partir de ella, que dará lugar a una proteína.

    Así, el RNA mensajero es leído y se produce la proteína mediante el uso de los aminoácidos, unas moléculas peptídicas que producimos en el cuerpo o ingerimos con la dieta (aminoácidos esenciales). Así, mediante la maquinaria celular un RNA mensajero es convertido a proteína mediante la interpretación del código genético (que es universal):



    La imagen superior esquematiza el código genético. Este se lee en “codones”, o lo que es lo mismo “en grupos de tres nucleótidos”. Como se ve en la imagen, los distintos codones dan lugar a un aminoácido concreto. Por ejemplo: UUU y UUC codifican el aminoácido Fen (fenilalanina).

    Siguiendo el ejemplo anterior, nuestra hebra era:

    UUUCGCUCACCGGUACUG

    La separamos en grupos de tres codones:

    UUU // CGC // UCA // CCG // GUA // CUG

    Y miramos qué aminoácido codifican con el código genético. Obteniendo:

    Fen – Arg – Ser – Pro – Val – Leu

    Los aminoácidos que aparecen, por si no conocéis la abreviatura son: fenialanina (Fen), arginina (Arg), serina (Ser), prolina (Pro), valina (Val) y leucina (Leu).

    Con esto la célula tendría su PROTEÍNA CONSTRUIDA (interpretada desde su código genético), que mediante los mecanismos apropiados (con ayuda de otras proteínas llamadas chaperonas) se plegaría para tener la estructura correcta y ejercer su función en la célula (por ejemplo, puede ser una proteína que forme un canal de calcio dimérico que se abra al unir su ligando liberando el calcio intracelular).

    ----------------------------

    Aunque no creo que mucha gente haya llegado hasta aquí, si los que lo habéis hecho tenéis preguntas, podéis hacerlas. Intentaré responder lo mejor que sepa / pueda.

    Responder
  • sarik

    Agregar como amigo

    Registrado: 07/04/2012
    Posts: 569

    #1

    15/05/2012, 23:37

    #0 En este tema iré escribiendo pequeños artículos de genética básica, para el que esté interesado. Seguramente escriba más de uno, por lo que os recomiendo que no leáis exclusivamente el primer post del tema si acaba teniendo muchas hojas, y que busquéis si hay más información en el futuro.

    El texto es de mi puño y letra a no ser que especifique lo contrario. Las imágenes son todas de Internet.

    --------------------------------------------------------


    LOS GENES NO CODIFICAN CARACTERES, CODIFICAN PROTEÍNAS.

    ¿Por qué es importante entender esto?

    Mucha gente tiene la tendencia a pensar que un gen da lugar de forma invariable a un carácter. Es decir, que existe un gen de los ojos azules, un gen del pelo rubio, un gen de los brazos largos, un gen de la piel oscura… etc.

    Esto es absoluta y totalmente erróneo, y deriva del escasísimo conocimiento genético que tiene la población de hoy en día, cuyos conocimientos se derivan de la genética mendeliana donde se vieron estos sucesos. Los experimentos de Mendel explican la parte más sencilla de la genética, pero se quedan cortos (cortísimos) para hablar de temas más serios, como las enfermedades hereditarias de los perros, por ejemplo.

    Por eso es importante que quede BIEN CLARO que los genes NO DAN LUGAR a caracteres concretos, sino a proteínas. Y es la interacción de las proteínas entre ellas (o la carencia de esta interacción, en algunos casos) lo que da lugar a la mayoría de los caracteres genéticos.

    Para el que ande pez, un carácter es cualquier cosa que os queráis proponer. Desde el color de ojos, pasando por la altura de una persona, hasta la longitud del hueso de la mandíbula inferior o el color de la planta del pie. Todo eso está determinado, en parte por su BACKGROUND genético y en parte de forma ambiental (es decir, por el desarrollo embrionario, entre otros).



    Entonces, ¿qué es un gen molecularmente hablando?

    Una mirada hacia atrás: el DNA, ese gran desconocido.

    Si atendemos al DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR, propuesto por Watson y Crick a raíz de su descubrimiento de la estructura molecular del DNA (estudios por los que obtendrían el premio Nobel) se propone un flujo unidireccional de la información genética (que hoy día se ha demostrado que tiene excepciones pero que nos sirve para lo que queremos explicar).

    La información genética de un individuo está "guardada" en su DNA. El DNA es simplemente una molécula en forma de doble hélice formada por unidades que se emparejan con la otra hebra de manera concreta. Tenemos 4 unidades (nucleótidos) distintos, Adenina (A), Guanina (G), Citosina (C) y Timina (T). Adenina siempre empareja con Timina a través de dos puentes de hidrógeno (un tipo de enlace químico) y Citosina lo hace con Guanina a través de tres puentes de hidrógeno. Gracias a esto se forma una estructura de doble hélice levógira (que gira a izquierdas) en la que se concentra toda la información genética de un individuo.



    ¿Cómo es eso posible?

    Es sencillo, y es la base del DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR. La información contenida en el DNA está en forma de CÓDIGO, de modo que cada una de las dos hebras que forman la molécula de DNA tiene un código "de letras" formado por sus nucleótidos. Por ejemplo, el código de una hebra de DNA puede ser:

    AAAGCGAGTAGTGGCCATGAC

    Los sistemas celulares saben interpretar este código y producir otras moléculas a partir de él, así es que a partir del DNA por un proceso que se conoce como TRANSCRIPCIÓN, y a través de unas enzimas (proteínas catalíticas) concretas obtenemos los distintos tipos de RNA (ribosómico, de transferencia y mensajero).


    ¿Interpretamos el código? Fabricando proteínas.

    Dejaremos de lado dos de los tipos de RNA y nos interesaremos por el RNA mensajero, pues es el que principalmente dará lugar a las proteínas de los organismos.

    Así es que a través del proceso de TRANSCRIPCIÓN el ejemplo de código anterior puede TRANSCRIBIRSE a RNA. El RNA se diferencia del DNA básicamente en un sustituyente (una ramificación) de la ribosa que forma el nucleótido y en que no existe el nucleótido Timina, en su lugar existe el Uracilo (U), que empareja con la Adenina igual que la Timina (con dos puentes de hidrógeno). Así si nosotros fuéramos una enzima (concretamente, una RNA polimerasa), TRANSCRIBIRÍAMOS el código de la hebra anterior a RNA mensajero así:

    UUUCGCUCACCGGUACUG

    Simplemente:
    Donde hay A ponemos U (pues la adenina empareja con uracilo).
    Donde hay T ponemos A (pues la timina empareja con la adenina).
    Donde hay G ponemos C (pues la guanina empareja con la citosina).
    Donde hay C ponemos G (pues la citosina empareja con la guanina).



    En la imagen se esquematiza el proceso de la transcripción. Las líneas azules representan las dos cadenas del DNA, que se mantienen superenrrolladas en condiciones normales. Durante la transcripción, mediante otras enzimas y un proceso molecular complejo se libera la tensión en la zona de interés (donde está el gen que queremos transcribir) para garantizar el acceso de la RNA polimerasa (pelota azul). La línea naranja representa el RNA mensajero que la RNA polimerasa se está encargando de generar. Como se puede observar, sólo una cadena del DNA se utiliza para la transcripción (cadena molde), la otra no se utiliza (cadena inactiva). El uso de una u otra, y en una dirección u otra dependerá de qué gen (o genes) esté la célula interesada en transcribir.

    Continuemos, ya tenemos el RNA mensajero… ¿De dónde sacamos la proteína?

    El proceso molecular de transmisión de la información génica no concluye con la transcripción, el RNA mensajero tiene que ser leído por la maquinaria celular para producir otras moléculas: las PROTEÍNAS. Este proceso se denomina TRADUCCIÓN, y se efectúa a través de la actuación de la maquinaria ribosomal de la célula (es decir, de los orgánulos celulares conocidos como “ribosomas”).



    La imagen muestra la estructura de un ribosoma. Está formado por dos subunidades que se conocen como “subunidad grande” y “subunidad pequeña”. Durante el proceso de traducción el ribosoma “lee” la hebra de RNA mensajero formada durante la traducción y construye una cadena peptídico a partir de ella, que dará lugar a una proteína.

    Así, el RNA mensajero es leído y se produce la proteína mediante el uso de los aminoácidos, unas moléculas peptídicas que producimos en el cuerpo o ingerimos con la dieta (aminoácidos esenciales). Así, mediante la maquinaria celular un RNA mensajero es convertido a proteína mediante la interpretación del código genético (que es universal):



    La imagen superior esquematiza el código genético. Este se lee en “codones”, o lo que es lo mismo “en grupos de tres nucleótidos”. Como se ve en la imagen, los distintos codones dan lugar a un aminoácido concreto. Por ejemplo: UUU y UUC codifican el aminoácido Fen (fenilalanina).

    Siguiendo el ejemplo anterior, nuestra hebra era:

    UUUCGCUCACCGGUACUG

    La separamos en grupos de tres codones:

    UUU // CGC // UCA // CCG // GUA // CUG

    Y miramos qué aminoácido codifican con el código genético. Obteniendo:

    Fen – Arg – Ser – Pro – Val – Leu

    Los aminoácidos que aparecen, por si no conocéis la abreviatura son: fenialanina (Fen), arginina (Arg), serina (Ser), prolina (Pro), valina (Val) y leucina (Leu).

    Con esto la célula tendría su PROTEÍNA CONSTRUIDA (interpretada desde su código genético), que mediante los mecanismos apropiados (con ayuda de otras proteínas llamadas chaperonas) se plegaría para tener la estructura correcta y ejercer su función en la célula (por ejemplo, puede ser una proteína que forme un canal de calcio dimérico que se abra al unir su ligando liberando el calcio intracelular).

    ----------------------------

    Aunque no creo que mucha gente haya llegado hasta aquí, si los que lo habéis hecho tenéis preguntas, podéis hacerlas. Intentaré responder lo mejor que sepa / pueda.
    gracias por explicarlo en terminos mas "entendibles" para los que no tenemos ni idea del tema pero tenemos curiosidad por todo.
    volveré a leerlo,se me escaparon cosas...
  • ukyo

    Agregar como amigo

    Registrado: 04/01/2011
    Posts: 2014

    #2

    16/05/2012, 00:23

    #1 #0 gracias por explicarlo en terminos mas "entendibles" para los que no tenemos ni idea del tema pero tenemos curiosidad por todo.
    volveré a leerlo,se me escaparon cosas...
    Gracias a ti. Si tienes alguna duda puedes preguntar también, igual incluso le sirve a otras personas.
  • isabelmb

    Agregar como amigo

    Registrado: 11/09/2010
    Posts: 7151

    #3

    16/05/2012, 01:07

    #0 En este tema iré escribiendo pequeños artículos de genética básica, para el que esté interesado. Seguramente escriba más de uno, por lo que os recomiendo que no leáis exclusivamente el primer post del tema si acaba teniendo muchas hojas, y que busquéis si hay más información en el futuro.

    El texto es de mi puño y letra a no ser que especifique lo contrario. Las imágenes son todas de Internet.

    --------------------------------------------------------


    LOS GENES NO CODIFICAN CARACTERES, CODIFICAN PROTEÍNAS.

    ¿Por qué es importante entender esto?

    Mucha gente tiene la tendencia a pensar que un gen da lugar de forma invariable a un carácter. Es decir, que existe un gen de los ojos azules, un gen del pelo rubio, un gen de los brazos largos, un gen de la piel oscura… etc.

    Esto es absoluta y totalmente erróneo, y deriva del escasísimo conocimiento genético que tiene la población de hoy en día, cuyos conocimientos se derivan de la genética mendeliana donde se vieron estos sucesos. Los experimentos de Mendel explican la parte más sencilla de la genética, pero se quedan cortos (cortísimos) para hablar de temas más serios, como las enfermedades hereditarias de los perros, por ejemplo.

    Por eso es importante que quede BIEN CLARO que los genes NO DAN LUGAR a caracteres concretos, sino a proteínas. Y es la interacción de las proteínas entre ellas (o la carencia de esta interacción, en algunos casos) lo que da lugar a la mayoría de los caracteres genéticos.

    Para el que ande pez, un carácter es cualquier cosa que os queráis proponer. Desde el color de ojos, pasando por la altura de una persona, hasta la longitud del hueso de la mandíbula inferior o el color de la planta del pie. Todo eso está determinado, en parte por su BACKGROUND genético y en parte de forma ambiental (es decir, por el desarrollo embrionario, entre otros).



    Entonces, ¿qué es un gen molecularmente hablando?

    Una mirada hacia atrás: el DNA, ese gran desconocido.

    Si atendemos al DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR, propuesto por Watson y Crick a raíz de su descubrimiento de la estructura molecular del DNA (estudios por los que obtendrían el premio Nobel) se propone un flujo unidireccional de la información genética (que hoy día se ha demostrado que tiene excepciones pero que nos sirve para lo que queremos explicar).

    La información genética de un individuo está "guardada" en su DNA. El DNA es simplemente una molécula en forma de doble hélice formada por unidades que se emparejan con la otra hebra de manera concreta. Tenemos 4 unidades (nucleótidos) distintos, Adenina (A), Guanina (G), Citosina (C) y Timina (T). Adenina siempre empareja con Timina a través de dos puentes de hidrógeno (un tipo de enlace químico) y Citosina lo hace con Guanina a través de tres puentes de hidrógeno. Gracias a esto se forma una estructura de doble hélice levógira (que gira a izquierdas) en la que se concentra toda la información genética de un individuo.



    ¿Cómo es eso posible?

    Es sencillo, y es la base del DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR. La información contenida en el DNA está en forma de CÓDIGO, de modo que cada una de las dos hebras que forman la molécula de DNA tiene un código "de letras" formado por sus nucleótidos. Por ejemplo, el código de una hebra de DNA puede ser:

    AAAGCGAGTAGTGGCCATGAC

    Los sistemas celulares saben interpretar este código y producir otras moléculas a partir de él, así es que a partir del DNA por un proceso que se conoce como TRANSCRIPCIÓN, y a través de unas enzimas (proteínas catalíticas) concretas obtenemos los distintos tipos de RNA (ribosómico, de transferencia y mensajero).


    ¿Interpretamos el código? Fabricando proteínas.

    Dejaremos de lado dos de los tipos de RNA y nos interesaremos por el RNA mensajero, pues es el que principalmente dará lugar a las proteínas de los organismos.

    Así es que a través del proceso de TRANSCRIPCIÓN el ejemplo de código anterior puede TRANSCRIBIRSE a RNA. El RNA se diferencia del DNA básicamente en un sustituyente (una ramificación) de la ribosa que forma el nucleótido y en que no existe el nucleótido Timina, en su lugar existe el Uracilo (U), que empareja con la Adenina igual que la Timina (con dos puentes de hidrógeno). Así si nosotros fuéramos una enzima (concretamente, una RNA polimerasa), TRANSCRIBIRÍAMOS el código de la hebra anterior a RNA mensajero así:

    UUUCGCUCACCGGUACUG

    Simplemente:
    Donde hay A ponemos U (pues la adenina empareja con uracilo).
    Donde hay T ponemos A (pues la timina empareja con la adenina).
    Donde hay G ponemos C (pues la guanina empareja con la citosina).
    Donde hay C ponemos G (pues la citosina empareja con la guanina).



    En la imagen se esquematiza el proceso de la transcripción. Las líneas azules representan las dos cadenas del DNA, que se mantienen superenrrolladas en condiciones normales. Durante la transcripción, mediante otras enzimas y un proceso molecular complejo se libera la tensión en la zona de interés (donde está el gen que queremos transcribir) para garantizar el acceso de la RNA polimerasa (pelota azul). La línea naranja representa el RNA mensajero que la RNA polimerasa se está encargando de generar. Como se puede observar, sólo una cadena del DNA se utiliza para la transcripción (cadena molde), la otra no se utiliza (cadena inactiva). El uso de una u otra, y en una dirección u otra dependerá de qué gen (o genes) esté la célula interesada en transcribir.

    Continuemos, ya tenemos el RNA mensajero… ¿De dónde sacamos la proteína?

    El proceso molecular de transmisión de la información génica no concluye con la transcripción, el RNA mensajero tiene que ser leído por la maquinaria celular para producir otras moléculas: las PROTEÍNAS. Este proceso se denomina TRADUCCIÓN, y se efectúa a través de la actuación de la maquinaria ribosomal de la célula (es decir, de los orgánulos celulares conocidos como “ribosomas”).



    La imagen muestra la estructura de un ribosoma. Está formado por dos subunidades que se conocen como “subunidad grande” y “subunidad pequeña”. Durante el proceso de traducción el ribosoma “lee” la hebra de RNA mensajero formada durante la traducción y construye una cadena peptídico a partir de ella, que dará lugar a una proteína.

    Así, el RNA mensajero es leído y se produce la proteína mediante el uso de los aminoácidos, unas moléculas peptídicas que producimos en el cuerpo o ingerimos con la dieta (aminoácidos esenciales). Así, mediante la maquinaria celular un RNA mensajero es convertido a proteína mediante la interpretación del código genético (que es universal):



    La imagen superior esquematiza el código genético. Este se lee en “codones”, o lo que es lo mismo “en grupos de tres nucleótidos”. Como se ve en la imagen, los distintos codones dan lugar a un aminoácido concreto. Por ejemplo: UUU y UUC codifican el aminoácido Fen (fenilalanina).

    Siguiendo el ejemplo anterior, nuestra hebra era:

    UUUCGCUCACCGGUACUG

    La separamos en grupos de tres codones:

    UUU // CGC // UCA // CCG // GUA // CUG

    Y miramos qué aminoácido codifican con el código genético. Obteniendo:

    Fen – Arg – Ser – Pro – Val – Leu

    Los aminoácidos que aparecen, por si no conocéis la abreviatura son: fenialanina (Fen), arginina (Arg), serina (Ser), prolina (Pro), valina (Val) y leucina (Leu).

    Con esto la célula tendría su PROTEÍNA CONSTRUIDA (interpretada desde su código genético), que mediante los mecanismos apropiados (con ayuda de otras proteínas llamadas chaperonas) se plegaría para tener la estructura correcta y ejercer su función en la célula (por ejemplo, puede ser una proteína que forme un canal de calcio dimérico que se abra al unir su ligando liberando el calcio intracelular).

    ----------------------------

    Aunque no creo que mucha gente haya llegado hasta aquí, si los que lo habéis hecho tenéis preguntas, podéis hacerlas. Intentaré responder lo mejor que sepa / pueda.
    Muchas gracias, a veces se ve que me falta algo de base para entender algunos conceptos, pero está muy bien explicado ahora, parece que lo voy entendiendo ¡nunca me acostaré sin saber algo más!!!!
  • ukyo

    Agregar como amigo

    Registrado: 04/01/2011
    Posts: 2014

    #4

    16/05/2012, 14:43

    #3 #0 Muchas gracias, a veces se ve que me falta algo de base para entender algunos conceptos, pero está muy bien explicado ahora, parece que lo voy entendiendo ¡nunca me acostaré sin saber algo más!!!!
    ;)
  • dar15

    Agregar como amigo

    Registrado: 28/02/2012
    Posts: 2364

    #5

    16/05/2012, 14:52

    #0 En este tema iré escribiendo pequeños artículos de genética básica, para el que esté interesado. Seguramente escriba más de uno, por lo que os recomiendo que no leáis exclusivamente el primer post del tema si acaba teniendo muchas hojas, y que busquéis si hay más información en el futuro.

    El texto es de mi puño y letra a no ser que especifique lo contrario. Las imágenes son todas de Internet.

    --------------------------------------------------------


    LOS GENES NO CODIFICAN CARACTERES, CODIFICAN PROTEÍNAS.

    ¿Por qué es importante entender esto?

    Mucha gente tiene la tendencia a pensar que un gen da lugar de forma invariable a un carácter. Es decir, que existe un gen de los ojos azules, un gen del pelo rubio, un gen de los brazos largos, un gen de la piel oscura… etc.

    Esto es absoluta y totalmente erróneo, y deriva del escasísimo conocimiento genético que tiene la población de hoy en día, cuyos conocimientos se derivan de la genética mendeliana donde se vieron estos sucesos. Los experimentos de Mendel explican la parte más sencilla de la genética, pero se quedan cortos (cortísimos) para hablar de temas más serios, como las enfermedades hereditarias de los perros, por ejemplo.

    Por eso es importante que quede BIEN CLARO que los genes NO DAN LUGAR a caracteres concretos, sino a proteínas. Y es la interacción de las proteínas entre ellas (o la carencia de esta interacción, en algunos casos) lo que da lugar a la mayoría de los caracteres genéticos.

    Para el que ande pez, un carácter es cualquier cosa que os queráis proponer. Desde el color de ojos, pasando por la altura de una persona, hasta la longitud del hueso de la mandíbula inferior o el color de la planta del pie. Todo eso está determinado, en parte por su BACKGROUND genético y en parte de forma ambiental (es decir, por el desarrollo embrionario, entre otros).



    Entonces, ¿qué es un gen molecularmente hablando?

    Una mirada hacia atrás: el DNA, ese gran desconocido.

    Si atendemos al DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR, propuesto por Watson y Crick a raíz de su descubrimiento de la estructura molecular del DNA (estudios por los que obtendrían el premio Nobel) se propone un flujo unidireccional de la información genética (que hoy día se ha demostrado que tiene excepciones pero que nos sirve para lo que queremos explicar).

    La información genética de un individuo está "guardada" en su DNA. El DNA es simplemente una molécula en forma de doble hélice formada por unidades que se emparejan con la otra hebra de manera concreta. Tenemos 4 unidades (nucleótidos) distintos, Adenina (A), Guanina (G), Citosina (C) y Timina (T). Adenina siempre empareja con Timina a través de dos puentes de hidrógeno (un tipo de enlace químico) y Citosina lo hace con Guanina a través de tres puentes de hidrógeno. Gracias a esto se forma una estructura de doble hélice levógira (que gira a izquierdas) en la que se concentra toda la información genética de un individuo.



    ¿Cómo es eso posible?

    Es sencillo, y es la base del DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR. La información contenida en el DNA está en forma de CÓDIGO, de modo que cada una de las dos hebras que forman la molécula de DNA tiene un código "de letras" formado por sus nucleótidos. Por ejemplo, el código de una hebra de DNA puede ser:

    AAAGCGAGTAGTGGCCATGAC

    Los sistemas celulares saben interpretar este código y producir otras moléculas a partir de él, así es que a partir del DNA por un proceso que se conoce como TRANSCRIPCIÓN, y a través de unas enzimas (proteínas catalíticas) concretas obtenemos los distintos tipos de RNA (ribosómico, de transferencia y mensajero).


    ¿Interpretamos el código? Fabricando proteínas.

    Dejaremos de lado dos de los tipos de RNA y nos interesaremos por el RNA mensajero, pues es el que principalmente dará lugar a las proteínas de los organismos.

    Así es que a través del proceso de TRANSCRIPCIÓN el ejemplo de código anterior puede TRANSCRIBIRSE a RNA. El RNA se diferencia del DNA básicamente en un sustituyente (una ramificación) de la ribosa que forma el nucleótido y en que no existe el nucleótido Timina, en su lugar existe el Uracilo (U), que empareja con la Adenina igual que la Timina (con dos puentes de hidrógeno). Así si nosotros fuéramos una enzima (concretamente, una RNA polimerasa), TRANSCRIBIRÍAMOS el código de la hebra anterior a RNA mensajero así:

    UUUCGCUCACCGGUACUG

    Simplemente:
    Donde hay A ponemos U (pues la adenina empareja con uracilo).
    Donde hay T ponemos A (pues la timina empareja con la adenina).
    Donde hay G ponemos C (pues la guanina empareja con la citosina).
    Donde hay C ponemos G (pues la citosina empareja con la guanina).



    En la imagen se esquematiza el proceso de la transcripción. Las líneas azules representan las dos cadenas del DNA, que se mantienen superenrrolladas en condiciones normales. Durante la transcripción, mediante otras enzimas y un proceso molecular complejo se libera la tensión en la zona de interés (donde está el gen que queremos transcribir) para garantizar el acceso de la RNA polimerasa (pelota azul). La línea naranja representa el RNA mensajero que la RNA polimerasa se está encargando de generar. Como se puede observar, sólo una cadena del DNA se utiliza para la transcripción (cadena molde), la otra no se utiliza (cadena inactiva). El uso de una u otra, y en una dirección u otra dependerá de qué gen (o genes) esté la célula interesada en transcribir.

    Continuemos, ya tenemos el RNA mensajero… ¿De dónde sacamos la proteína?

    El proceso molecular de transmisión de la información génica no concluye con la transcripción, el RNA mensajero tiene que ser leído por la maquinaria celular para producir otras moléculas: las PROTEÍNAS. Este proceso se denomina TRADUCCIÓN, y se efectúa a través de la actuación de la maquinaria ribosomal de la célula (es decir, de los orgánulos celulares conocidos como “ribosomas”).



    La imagen muestra la estructura de un ribosoma. Está formado por dos subunidades que se conocen como “subunidad grande” y “subunidad pequeña”. Durante el proceso de traducción el ribosoma “lee” la hebra de RNA mensajero formada durante la traducción y construye una cadena peptídico a partir de ella, que dará lugar a una proteína.

    Así, el RNA mensajero es leído y se produce la proteína mediante el uso de los aminoácidos, unas moléculas peptídicas que producimos en el cuerpo o ingerimos con la dieta (aminoácidos esenciales). Así, mediante la maquinaria celular un RNA mensajero es convertido a proteína mediante la interpretación del código genético (que es universal):



    La imagen superior esquematiza el código genético. Este se lee en “codones”, o lo que es lo mismo “en grupos de tres nucleótidos”. Como se ve en la imagen, los distintos codones dan lugar a un aminoácido concreto. Por ejemplo: UUU y UUC codifican el aminoácido Fen (fenilalanina).

    Siguiendo el ejemplo anterior, nuestra hebra era:

    UUUCGCUCACCGGUACUG

    La separamos en grupos de tres codones:

    UUU // CGC // UCA // CCG // GUA // CUG

    Y miramos qué aminoácido codifican con el código genético. Obteniendo:

    Fen – Arg – Ser – Pro – Val – Leu

    Los aminoácidos que aparecen, por si no conocéis la abreviatura son: fenialanina (Fen), arginina (Arg), serina (Ser), prolina (Pro), valina (Val) y leucina (Leu).

    Con esto la célula tendría su PROTEÍNA CONSTRUIDA (interpretada desde su código genético), que mediante los mecanismos apropiados (con ayuda de otras proteínas llamadas chaperonas) se plegaría para tener la estructura correcta y ejercer su función en la célula (por ejemplo, puede ser una proteína que forme un canal de calcio dimérico que se abra al unir su ligando liberando el calcio intracelular).

    ----------------------------

    Aunque no creo que mucha gente haya llegado hasta aquí, si los que lo habéis hecho tenéis preguntas, podéis hacerlas. Intentaré responder lo mejor que sepa / pueda.
    Cuánto voy a aprender!!!

    Lo mejor es que siempre que leo de genética no tengo a quien preguntar las dudas, ahora te tengo a ti! Jajajaja

    Te felicito por abrir un post interesante de verdad!
  • ittm

    Agregar como amigo

    Registrado: 04/05/2011
    Posts: 3650

    #6

    16/05/2012, 15:50

    #0 En este tema iré escribiendo pequeños artículos de genética básica, para el que esté interesado. Seguramente escriba más de uno, por lo que os recomiendo que no leáis exclusivamente el primer post del tema si acaba teniendo muchas hojas, y que busquéis si hay más información en el futuro.

    El texto es de mi puño y letra a no ser que especifique lo contrario. Las imágenes son todas de Internet.

    --------------------------------------------------------


    LOS GENES NO CODIFICAN CARACTERES, CODIFICAN PROTEÍNAS.

    ¿Por qué es importante entender esto?

    Mucha gente tiene la tendencia a pensar que un gen da lugar de forma invariable a un carácter. Es decir, que existe un gen de los ojos azules, un gen del pelo rubio, un gen de los brazos largos, un gen de la piel oscura… etc.

    Esto es absoluta y totalmente erróneo, y deriva del escasísimo conocimiento genético que tiene la población de hoy en día, cuyos conocimientos se derivan de la genética mendeliana donde se vieron estos sucesos. Los experimentos de Mendel explican la parte más sencilla de la genética, pero se quedan cortos (cortísimos) para hablar de temas más serios, como las enfermedades hereditarias de los perros, por ejemplo.

    Por eso es importante que quede BIEN CLARO que los genes NO DAN LUGAR a caracteres concretos, sino a proteínas. Y es la interacción de las proteínas entre ellas (o la carencia de esta interacción, en algunos casos) lo que da lugar a la mayoría de los caracteres genéticos.

    Para el que ande pez, un carácter es cualquier cosa que os queráis proponer. Desde el color de ojos, pasando por la altura de una persona, hasta la longitud del hueso de la mandíbula inferior o el color de la planta del pie. Todo eso está determinado, en parte por su BACKGROUND genético y en parte de forma ambiental (es decir, por el desarrollo embrionario, entre otros).



    Entonces, ¿qué es un gen molecularmente hablando?

    Una mirada hacia atrás: el DNA, ese gran desconocido.

    Si atendemos al DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR, propuesto por Watson y Crick a raíz de su descubrimiento de la estructura molecular del DNA (estudios por los que obtendrían el premio Nobel) se propone un flujo unidireccional de la información genética (que hoy día se ha demostrado que tiene excepciones pero que nos sirve para lo que queremos explicar).

    La información genética de un individuo está "guardada" en su DNA. El DNA es simplemente una molécula en forma de doble hélice formada por unidades que se emparejan con la otra hebra de manera concreta. Tenemos 4 unidades (nucleótidos) distintos, Adenina (A), Guanina (G), Citosina (C) y Timina (T). Adenina siempre empareja con Timina a través de dos puentes de hidrógeno (un tipo de enlace químico) y Citosina lo hace con Guanina a través de tres puentes de hidrógeno. Gracias a esto se forma una estructura de doble hélice levógira (que gira a izquierdas) en la que se concentra toda la información genética de un individuo.



    ¿Cómo es eso posible?

    Es sencillo, y es la base del DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR. La información contenida en el DNA está en forma de CÓDIGO, de modo que cada una de las dos hebras que forman la molécula de DNA tiene un código "de letras" formado por sus nucleótidos. Por ejemplo, el código de una hebra de DNA puede ser:

    AAAGCGAGTAGTGGCCATGAC

    Los sistemas celulares saben interpretar este código y producir otras moléculas a partir de él, así es que a partir del DNA por un proceso que se conoce como TRANSCRIPCIÓN, y a través de unas enzimas (proteínas catalíticas) concretas obtenemos los distintos tipos de RNA (ribosómico, de transferencia y mensajero).


    ¿Interpretamos el código? Fabricando proteínas.

    Dejaremos de lado dos de los tipos de RNA y nos interesaremos por el RNA mensajero, pues es el que principalmente dará lugar a las proteínas de los organismos.

    Así es que a través del proceso de TRANSCRIPCIÓN el ejemplo de código anterior puede TRANSCRIBIRSE a RNA. El RNA se diferencia del DNA básicamente en un sustituyente (una ramificación) de la ribosa que forma el nucleótido y en que no existe el nucleótido Timina, en su lugar existe el Uracilo (U), que empareja con la Adenina igual que la Timina (con dos puentes de hidrógeno). Así si nosotros fuéramos una enzima (concretamente, una RNA polimerasa), TRANSCRIBIRÍAMOS el código de la hebra anterior a RNA mensajero así:

    UUUCGCUCACCGGUACUG

    Simplemente:
    Donde hay A ponemos U (pues la adenina empareja con uracilo).
    Donde hay T ponemos A (pues la timina empareja con la adenina).
    Donde hay G ponemos C (pues la guanina empareja con la citosina).
    Donde hay C ponemos G (pues la citosina empareja con la guanina).



    En la imagen se esquematiza el proceso de la transcripción. Las líneas azules representan las dos cadenas del DNA, que se mantienen superenrrolladas en condiciones normales. Durante la transcripción, mediante otras enzimas y un proceso molecular complejo se libera la tensión en la zona de interés (donde está el gen que queremos transcribir) para garantizar el acceso de la RNA polimerasa (pelota azul). La línea naranja representa el RNA mensajero que la RNA polimerasa se está encargando de generar. Como se puede observar, sólo una cadena del DNA se utiliza para la transcripción (cadena molde), la otra no se utiliza (cadena inactiva). El uso de una u otra, y en una dirección u otra dependerá de qué gen (o genes) esté la célula interesada en transcribir.

    Continuemos, ya tenemos el RNA mensajero… ¿De dónde sacamos la proteína?

    El proceso molecular de transmisión de la información génica no concluye con la transcripción, el RNA mensajero tiene que ser leído por la maquinaria celular para producir otras moléculas: las PROTEÍNAS. Este proceso se denomina TRADUCCIÓN, y se efectúa a través de la actuación de la maquinaria ribosomal de la célula (es decir, de los orgánulos celulares conocidos como “ribosomas”).



    La imagen muestra la estructura de un ribosoma. Está formado por dos subunidades que se conocen como “subunidad grande” y “subunidad pequeña”. Durante el proceso de traducción el ribosoma “lee” la hebra de RNA mensajero formada durante la traducción y construye una cadena peptídico a partir de ella, que dará lugar a una proteína.

    Así, el RNA mensajero es leído y se produce la proteína mediante el uso de los aminoácidos, unas moléculas peptídicas que producimos en el cuerpo o ingerimos con la dieta (aminoácidos esenciales). Así, mediante la maquinaria celular un RNA mensajero es convertido a proteína mediante la interpretación del código genético (que es universal):



    La imagen superior esquematiza el código genético. Este se lee en “codones”, o lo que es lo mismo “en grupos de tres nucleótidos”. Como se ve en la imagen, los distintos codones dan lugar a un aminoácido concreto. Por ejemplo: UUU y UUC codifican el aminoácido Fen (fenilalanina).

    Siguiendo el ejemplo anterior, nuestra hebra era:

    UUUCGCUCACCGGUACUG

    La separamos en grupos de tres codones:

    UUU // CGC // UCA // CCG // GUA // CUG

    Y miramos qué aminoácido codifican con el código genético. Obteniendo:

    Fen – Arg – Ser – Pro – Val – Leu

    Los aminoácidos que aparecen, por si no conocéis la abreviatura son: fenialanina (Fen), arginina (Arg), serina (Ser), prolina (Pro), valina (Val) y leucina (Leu).

    Con esto la célula tendría su PROTEÍNA CONSTRUIDA (interpretada desde su código genético), que mediante los mecanismos apropiados (con ayuda de otras proteínas llamadas chaperonas) se plegaría para tener la estructura correcta y ejercer su función en la célula (por ejemplo, puede ser una proteína que forme un canal de calcio dimérico que se abra al unir su ligando liberando el calcio intracelular).

    ----------------------------

    Aunque no creo que mucha gente haya llegado hasta aquí, si los que lo habéis hecho tenéis preguntas, podéis hacerlas. Intentaré responder lo mejor que sepa / pueda.
  • ukyo

    Agregar como amigo

    Registrado: 04/01/2011
    Posts: 2014

    #7

    16/05/2012, 16:58

    EL CROMOSOMA COMO UNIDAD HEREDITARIA.

    ¿Qué es un cromosoma? ¿Cómo se heredan los genes?

    En el organismo, el DNA se empaqueta (se condensa, para ocupar menos espacio) y almacena en los núcleos de las células en unas estructuras llamadas CROMOSOMAS.



    En la imagen tenemos esquematizada la estructura de un cromosoma, y cómo se presentan en la célula. Como se puede observar el cromosoma es simplemente una enorme agrupación de DNA, enrollado y comprimido al máximo para que ocupe el mínimo espacio en la célula. Esto es importante, pues el genoma humano, totalmente extendido, tiene una LONGITUD TOTAL DE 1.8 METROS, y eso tiene que caber en cada célula del organismo, de modo que es absolutamente necesario que ocupe el mínimo espacio posible.

    Hay que tener en cuenta que el DNA total de un individuo está repartido en los distintos cromosomas que posee, por lo que no está todo “unido”, sino separado en distintas unidades. Esto es importante para entender el proceso de transmisión de los genes desde los progenitores (padres) a los descendientes (hijos), y cómo se generan problemas cuando algo en este proceso de transmisión de la información falla.

    Retomando el tema, de estos cromosomas existe en cada célula del organismo una cantidad que es característica de la especie. Por ejemplo, nosotros los humanos tenemos 46 cromosomas (22 parejas y un par de cromosomas sexuales) en nuestras células diploides, y en las células haploides tenemos 23 cromosomas (la mitad). Ahora definiremos los términos haploide y diploide.



    La imagen superior muestra un cariotipo humano, es decir, la colección de genes que tiene una célula (en el caso de la imagen, una célula diploide). Los cromosomas se ordenan en los cariotipos en diferentes grupos (A, B, C, D, E, F y G) en función de la longitud relativa de sus “brazos”.

    Las células no sexuales (es decir, aquellas que no son espermatozoides y óvulos) tienen dotación doble (repetida) de cromosomas, de modo que tienen una pareja de cada (dotación DIPLOIDE, como en la imagen superior). Cada miembro de esta pareja procede de un progenitor (es decir, uno será de su madre y otro de su padre).

    Como hemos dicho, los cromosomas son simplemente DNA superenrollado, y por lo tanto cada cromosoma tiene necesariamente un conjunto de genes concreto que es característico de la especie. Sin embargo, los cromosomas homólogos ("de la pareja") pueden tener diferentes versiones de cada gen que se conocen como ALELOS. Es decir, los genes pueden tener pequeños cambios en su secuencia de nucleótidos que les haga dar lugar a una proteína ligeramente distinta o directamente afuncional (“inútil”), esto es lo que conocemos como “alelos de un gen”.



    Veámoslo con un ejemplo práctico y sencillo:

    Imaginemos una especie de rosales que dan rosas de color rojo. Un buen día, podando nuestro rosal, nos encontramos una rosa de color blanco. ¿Cómo es esto posible? Lo que puede haber ocurrido es que la enzima (proteína catalítica) crítica para el color de los pétalos haya sufrido una mutación que haya vuelto afuncional, así esa enzima no se genera nunca correctamente y la flor no puede realizar el paso metabólico necesario para conseguir el pigmento de los pétalos. Una versión un poco más compleja que esta es lo que ocurre en la mayoría de los casos de albinismo en el reino animal.

    En este caso, tendríamos un gen (el gen que genera la enzima capaz de pigmentar la flor) y dos alelos (posibilidades para ese gen), el alelo “normal”, capaz de generar la enzima que pigmenta de rojo los pétalos, y el alelo “mutante” que da lugar a una enzima aberrante incapaz de llevar a cabo su función. La cosa podría complicarse más con más alelos, por ejemplo, podría haber una versión alélica que fuera menos eficiente que el “alelo normal”, y que por ello pigmentara la flor de rosa en lugar de rojo, porque no es capaz de generar tanto pigmento como el “alelo normal”. Así tendríamos un gen (que genera la enzima pigmentadora) y tres alelos, el normal (pigmenta de rojo), el menos eficiente (pigmenta de rosa) y el mutante (afuncional, no pigmenta).



    Continuando con el tema anterior, en los gametos (células sexuales) sólo existe UNA COPIA del cada cromosoma (dotación HAPLOIDE). Esta copia viene por BARAJADO ALEATORIO de las dos que tenía la célula (diploide) de la que se originó el gameto durante la GAMETOGÉNESIS (hablaré de la gametogénesis en otro artículo).

    Durante la fecundación, cada una de las células progenitoras (óvulo y espermatozoide) aporta pues UNA COPIA de cada uno de los cromosomas homólogos. Como se puede ver en la imagen. Se ha simplificado imaginando una especie que tiene únicamente dos cromosomas totales en dotación haploide (recordad, los humanos tenemos 23). El óvulo aportaría un “cromosoma 1” y un “cromosoma 2” y el espermatozoide otro “cromosoma 1” y otro “cromosoma 2”. El cigoto resultante sería una célula DIPLOIDE, con dos cromosomas 1 y dos cromosomas 2 homólogos, y cada homólogo procedería pues de un progenitor.



    El organismo tiene pues DOS COPIAS HOMÓLOGAS de cada secuencia de DNA, y tiene sus genes POR DUPLICADO. Esto permite que cada gen tenga DOS VERSIONES, una que viene del padre y otra que viene de la madre.

    En el organismo cada gen se expresa en un momento y lugar (del cuerpo) concreto dando lugar a una proteína (como veíamos antes en
    #0 En este tema iré escribiendo pequeños artículos de genética básica, para el que esté interesado. Seguramente escriba más de uno, por lo que os recomiendo que no leáis exclusivamente el primer post del tema si acaba teniendo muchas hojas, y que busquéis si hay más información en el futuro.

    El texto es de mi puño y letra a no ser que especifique lo contrario. Las imágenes son todas de Internet.

    --------------------------------------------------------


    LOS GENES NO CODIFICAN CARACTERES, CODIFICAN PROTEÍNAS.

    ¿Por qué es importante entender esto?

    Mucha gente tiene la tendencia a pensar que un gen da lugar de forma invariable a un carácter. Es decir, que existe un gen de los ojos azules, un gen del pelo rubio, un gen de los brazos largos, un gen de la piel oscura… etc.

    Esto es absoluta y totalmente erróneo, y deriva del escasísimo conocimiento genético que tiene la población de hoy en día, cuyos conocimientos se derivan de la genética mendeliana donde se vieron estos sucesos. Los experimentos de Mendel explican la parte más sencilla de la genética, pero se quedan cortos (cortísimos) para hablar de temas más serios, como las enfermedades hereditarias de los perros, por ejemplo.

    Por eso es importante que quede BIEN CLARO que los genes NO DAN LUGAR a caracteres concretos, sino a proteínas. Y es la interacción de las proteínas entre ellas (o la carencia de esta interacción, en algunos casos) lo que da lugar a la mayoría de los caracteres genéticos.

    Para el que ande pez, un carácter es cualquier cosa que os queráis proponer. Desde el color de ojos, pasando por la altura de una persona, hasta la longitud del hueso de la mandíbula inferior o el color de la planta del pie. Todo eso está determinado, en parte por su BACKGROUND genético y en parte de forma ambiental (es decir, por el desarrollo embrionario, entre otros).



    Entonces, ¿qué es un gen molecularmente hablando?

    Una mirada hacia atrás: el DNA, ese gran desconocido.

    Si atendemos al DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR, propuesto por Watson y Crick a raíz de su descubrimiento de la estructura molecular del DNA (estudios por los que obtendrían el premio Nobel) se propone un flujo unidireccional de la información genética (que hoy día se ha demostrado que tiene excepciones pero que nos sirve para lo que queremos explicar).

    La información genética de un individuo está "guardada" en su DNA. El DNA es simplemente una molécula en forma de doble hélice formada por unidades que se emparejan con la otra hebra de manera concreta. Tenemos 4 unidades (nucleótidos) distintos, Adenina (A), Guanina (G), Citosina (C) y Timina (T). Adenina siempre empareja con Timina a través de dos puentes de hidrógeno (un tipo de enlace químico) y Citosina lo hace con Guanina a través de tres puentes de hidrógeno. Gracias a esto se forma una estructura de doble hélice levógira (que gira a izquierdas) en la que se concentra toda la información genética de un individuo.



    ¿Cómo es eso posible?

    Es sencillo, y es la base del DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR. La información contenida en el DNA está en forma de CÓDIGO, de modo que cada una de las dos hebras que forman la molécula de DNA tiene un código "de letras" formado por sus nucleótidos. Por ejemplo, el código de una hebra de DNA puede ser:

    AAAGCGAGTAGTGGCCATGAC

    Los sistemas celulares saben interpretar este código y producir otras moléculas a partir de él, así es que a partir del DNA por un proceso que se conoce como TRANSCRIPCIÓN, y a través de unas enzimas (proteínas catalíticas) concretas obtenemos los distintos tipos de RNA (ribosómico, de transferencia y mensajero).


    ¿Interpretamos el código? Fabricando proteínas.

    Dejaremos de lado dos de los tipos de RNA y nos interesaremos por el RNA mensajero, pues es el que principalmente dará lugar a las proteínas de los organismos.

    Así es que a través del proceso de TRANSCRIPCIÓN el ejemplo de código anterior puede TRANSCRIBIRSE a RNA. El RNA se diferencia del DNA básicamente en un sustituyente (una ramificación) de la ribosa que forma el nucleótido y en que no existe el nucleótido Timina, en su lugar existe el Uracilo (U), que empareja con la Adenina igual que la Timina (con dos puentes de hidrógeno). Así si nosotros fuéramos una enzima (concretamente, una RNA polimerasa), TRANSCRIBIRÍAMOS el código de la hebra anterior a RNA mensajero así:

    UUUCGCUCACCGGUACUG

    Simplemente:
    Donde hay A ponemos U (pues la adenina empareja con uracilo).
    Donde hay T ponemos A (pues la timina empareja con la adenina).
    Donde hay G ponemos C (pues la guanina empareja con la citosina).
    Donde hay C ponemos G (pues la citosina empareja con la guanina).



    En la imagen se esquematiza el proceso de la transcripción. Las líneas azules representan las dos cadenas del DNA, que se mantienen superenrrolladas en condiciones normales. Durante la transcripción, mediante otras enzimas y un proceso molecular complejo se libera la tensión en la zona de interés (donde está el gen que queremos transcribir) para garantizar el acceso de la RNA polimerasa (pelota azul). La línea naranja representa el RNA mensajero que la RNA polimerasa se está encargando de generar. Como se puede observar, sólo una cadena del DNA se utiliza para la transcripción (cadena molde), la otra no se utiliza (cadena inactiva). El uso de una u otra, y en una dirección u otra dependerá de qué gen (o genes) esté la célula interesada en transcribir.

    Continuemos, ya tenemos el RNA mensajero… ¿De dónde sacamos la proteína?

    El proceso molecular de transmisión de la información génica no concluye con la transcripción, el RNA mensajero tiene que ser leído por la maquinaria celular para producir otras moléculas: las PROTEÍNAS. Este proceso se denomina TRADUCCIÓN, y se efectúa a través de la actuación de la maquinaria ribosomal de la célula (es decir, de los orgánulos celulares conocidos como “ribosomas”).



    La imagen muestra la estructura de un ribosoma. Está formado por dos subunidades que se conocen como “subunidad grande” y “subunidad pequeña”. Durante el proceso de traducción el ribosoma “lee” la hebra de RNA mensajero formada durante la traducción y construye una cadena peptídico a partir de ella, que dará lugar a una proteína.

    Así, el RNA mensajero es leído y se produce la proteína mediante el uso de los aminoácidos, unas moléculas peptídicas que producimos en el cuerpo o ingerimos con la dieta (aminoácidos esenciales). Así, mediante la maquinaria celular un RNA mensajero es convertido a proteína mediante la interpretación del código genético (que es universal):



    La imagen superior esquematiza el código genético. Este se lee en “codones”, o lo que es lo mismo “en grupos de tres nucleótidos”. Como se ve en la imagen, los distintos codones dan lugar a un aminoácido concreto. Por ejemplo: UUU y UUC codifican el aminoácido Fen (fenilalanina).

    Siguiendo el ejemplo anterior, nuestra hebra era:

    UUUCGCUCACCGGUACUG

    La separamos en grupos de tres codones:

    UUU // CGC // UCA // CCG // GUA // CUG

    Y miramos qué aminoácido codifican con el código genético. Obteniendo:

    Fen – Arg – Ser – Pro – Val – Leu

    Los aminoácidos que aparecen, por si no conocéis la abreviatura son: fenialanina (Fen), arginina (Arg), serina (Ser), prolina (Pro), valina (Val) y leucina (Leu).

    Con esto la célula tendría su PROTEÍNA CONSTRUIDA (interpretada desde su código genético), que mediante los mecanismos apropiados (con ayuda de otras proteínas llamadas chaperonas) se plegaría para tener la estructura correcta y ejercer su función en la célula (por ejemplo, puede ser una proteína que forme un canal de calcio dimérico que se abra al unir su ligando liberando el calcio intracelular).

    ----------------------------

    Aunque no creo que mucha gente haya llegado hasta aquí, si los que lo habéis hecho tenéis preguntas, podéis hacerlas. Intentaré responder lo mejor que sepa / pueda.
    )
    . La presencia de estas proteínas puede determinar el estado de un carácter. Hay caracteres raros, que llamamos "monogénicos" o "mendelianos" cuyo estado está condicionado por la presencia del alelo de una única proteína (en el ejemplo de la rosa se proponía así). Aunque en general, como la definición de un carácter es arbitraria, el estado de ese carácter suele estar influenciado por multitud de factores genéticos (alelos de hasta cientos de genes) y de factores ambientales (desarrollo...), un ejemplo de esto es la displasia de cadera. No existe un “gen de la displasia de cadera”, si no que la patología está influenciada por varios genes que determinan la forma del acetábulo y de la cabeza del fémur, y por factores ambientales tales como el desarrollo del perro durante su juventud (si fuerza la extremidad puede agravar la displasia), la obesidad (el peso sobre la cadera agrava las patologías de cadera)… etc.

    Es importante quedarse con la idea de que NO HEREDAMOS GENES de nuestros padres sino CROMOSOMAS, y cada cromosoma tiene un conjunto concreto de genes. Así es como sucede que hay enfermedades que se relacionan con ciertas características fenotípicas, porque los genes que las influencian se encuentran en el mismo cromosoma que los genes que dan esas características fenotípicas.

    -------------------------------

    Otro capitulillo-tostón para el que quiera leer. Si tenéis preguntas ya sabéis...

    #6 #0
    #5 #0 Cuánto voy a aprender!!!

    Lo mejor es que siempre que leo de genética no tengo a quien preguntar las dudas, ahora te tengo a ti! Jajajaja

    Te felicito por abrir un post interesante de verdad!
    #3 #0 Muchas gracias, a veces se ve que me falta algo de base para entender algunos conceptos, pero está muy bien explicado ahora, parece que lo voy entendiendo ¡nunca me acostaré sin saber algo más!!!!
    #1 #0 gracias por explicarlo en terminos mas "entendibles" para los que no tenemos ni idea del tema pero tenemos curiosidad por todo.
    volveré a leerlo,se me escaparon cosas...
  • joejlopez

    Agregar como amigo

    Registrado: 11/07/2011
    Posts: 4813

    #8

    16/05/2012, 17:23

    #0 En este tema iré escribiendo pequeños artículos de genética básica, para el que esté interesado. Seguramente escriba más de uno, por lo que os recomiendo que no leáis exclusivamente el primer post del tema si acaba teniendo muchas hojas, y que busquéis si hay más información en el futuro.

    El texto es de mi puño y letra a no ser que especifique lo contrario. Las imágenes son todas de Internet.

    --------------------------------------------------------


    LOS GENES NO CODIFICAN CARACTERES, CODIFICAN PROTEÍNAS.

    ¿Por qué es importante entender esto?

    Mucha gente tiene la tendencia a pensar que un gen da lugar de forma invariable a un carácter. Es decir, que existe un gen de los ojos azules, un gen del pelo rubio, un gen de los brazos largos, un gen de la piel oscura… etc.

    Esto es absoluta y totalmente erróneo, y deriva del escasísimo conocimiento genético que tiene la población de hoy en día, cuyos conocimientos se derivan de la genética mendeliana donde se vieron estos sucesos. Los experimentos de Mendel explican la parte más sencilla de la genética, pero se quedan cortos (cortísimos) para hablar de temas más serios, como las enfermedades hereditarias de los perros, por ejemplo.

    Por eso es importante que quede BIEN CLARO que los genes NO DAN LUGAR a caracteres concretos, sino a proteínas. Y es la interacción de las proteínas entre ellas (o la carencia de esta interacción, en algunos casos) lo que da lugar a la mayoría de los caracteres genéticos.

    Para el que ande pez, un carácter es cualquier cosa que os queráis proponer. Desde el color de ojos, pasando por la altura de una persona, hasta la longitud del hueso de la mandíbula inferior o el color de la planta del pie. Todo eso está determinado, en parte por su BACKGROUND genético y en parte de forma ambiental (es decir, por el desarrollo embrionario, entre otros).



    Entonces, ¿qué es un gen molecularmente hablando?

    Una mirada hacia atrás: el DNA, ese gran desconocido.

    Si atendemos al DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR, propuesto por Watson y Crick a raíz de su descubrimiento de la estructura molecular del DNA (estudios por los que obtendrían el premio Nobel) se propone un flujo unidireccional de la información genética (que hoy día se ha demostrado que tiene excepciones pero que nos sirve para lo que queremos explicar).

    La información genética de un individuo está "guardada" en su DNA. El DNA es simplemente una molécula en forma de doble hélice formada por unidades que se emparejan con la otra hebra de manera concreta. Tenemos 4 unidades (nucleótidos) distintos, Adenina (A), Guanina (G), Citosina (C) y Timina (T). Adenina siempre empareja con Timina a través de dos puentes de hidrógeno (un tipo de enlace químico) y Citosina lo hace con Guanina a través de tres puentes de hidrógeno. Gracias a esto se forma una estructura de doble hélice levógira (que gira a izquierdas) en la que se concentra toda la información genética de un individuo.



    ¿Cómo es eso posible?

    Es sencillo, y es la base del DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR. La información contenida en el DNA está en forma de CÓDIGO, de modo que cada una de las dos hebras que forman la molécula de DNA tiene un código "de letras" formado por sus nucleótidos. Por ejemplo, el código de una hebra de DNA puede ser:

    AAAGCGAGTAGTGGCCATGAC

    Los sistemas celulares saben interpretar este código y producir otras moléculas a partir de él, así es que a partir del DNA por un proceso que se conoce como TRANSCRIPCIÓN, y a través de unas enzimas (proteínas catalíticas) concretas obtenemos los distintos tipos de RNA (ribosómico, de transferencia y mensajero).


    ¿Interpretamos el código? Fabricando proteínas.

    Dejaremos de lado dos de los tipos de RNA y nos interesaremos por el RNA mensajero, pues es el que principalmente dará lugar a las proteínas de los organismos.

    Así es que a través del proceso de TRANSCRIPCIÓN el ejemplo de código anterior puede TRANSCRIBIRSE a RNA. El RNA se diferencia del DNA básicamente en un sustituyente (una ramificación) de la ribosa que forma el nucleótido y en que no existe el nucleótido Timina, en su lugar existe el Uracilo (U), que empareja con la Adenina igual que la Timina (con dos puentes de hidrógeno). Así si nosotros fuéramos una enzima (concretamente, una RNA polimerasa), TRANSCRIBIRÍAMOS el código de la hebra anterior a RNA mensajero así:

    UUUCGCUCACCGGUACUG

    Simplemente:
    Donde hay A ponemos U (pues la adenina empareja con uracilo).
    Donde hay T ponemos A (pues la timina empareja con la adenina).
    Donde hay G ponemos C (pues la guanina empareja con la citosina).
    Donde hay C ponemos G (pues la citosina empareja con la guanina).



    En la imagen se esquematiza el proceso de la transcripción. Las líneas azules representan las dos cadenas del DNA, que se mantienen superenrrolladas en condiciones normales. Durante la transcripción, mediante otras enzimas y un proceso molecular complejo se libera la tensión en la zona de interés (donde está el gen que queremos transcribir) para garantizar el acceso de la RNA polimerasa (pelota azul). La línea naranja representa el RNA mensajero que la RNA polimerasa se está encargando de generar. Como se puede observar, sólo una cadena del DNA se utiliza para la transcripción (cadena molde), la otra no se utiliza (cadena inactiva). El uso de una u otra, y en una dirección u otra dependerá de qué gen (o genes) esté la célula interesada en transcribir.

    Continuemos, ya tenemos el RNA mensajero… ¿De dónde sacamos la proteína?

    El proceso molecular de transmisión de la información génica no concluye con la transcripción, el RNA mensajero tiene que ser leído por la maquinaria celular para producir otras moléculas: las PROTEÍNAS. Este proceso se denomina TRADUCCIÓN, y se efectúa a través de la actuación de la maquinaria ribosomal de la célula (es decir, de los orgánulos celulares conocidos como “ribosomas”).



    La imagen muestra la estructura de un ribosoma. Está formado por dos subunidades que se conocen como “subunidad grande” y “subunidad pequeña”. Durante el proceso de traducción el ribosoma “lee” la hebra de RNA mensajero formada durante la traducción y construye una cadena peptídico a partir de ella, que dará lugar a una proteína.

    Así, el RNA mensajero es leído y se produce la proteína mediante el uso de los aminoácidos, unas moléculas peptídicas que producimos en el cuerpo o ingerimos con la dieta (aminoácidos esenciales). Así, mediante la maquinaria celular un RNA mensajero es convertido a proteína mediante la interpretación del código genético (que es universal):



    La imagen superior esquematiza el código genético. Este se lee en “codones”, o lo que es lo mismo “en grupos de tres nucleótidos”. Como se ve en la imagen, los distintos codones dan lugar a un aminoácido concreto. Por ejemplo: UUU y UUC codifican el aminoácido Fen (fenilalanina).

    Siguiendo el ejemplo anterior, nuestra hebra era:

    UUUCGCUCACCGGUACUG

    La separamos en grupos de tres codones:

    UUU // CGC // UCA // CCG // GUA // CUG

    Y miramos qué aminoácido codifican con el código genético. Obteniendo:

    Fen – Arg – Ser – Pro – Val – Leu

    Los aminoácidos que aparecen, por si no conocéis la abreviatura son: fenialanina (Fen), arginina (Arg), serina (Ser), prolina (Pro), valina (Val) y leucina (Leu).

    Con esto la célula tendría su PROTEÍNA CONSTRUIDA (interpretada desde su código genético), que mediante los mecanismos apropiados (con ayuda de otras proteínas llamadas chaperonas) se plegaría para tener la estructura correcta y ejercer su función en la célula (por ejemplo, puede ser una proteína que forme un canal de calcio dimérico que se abra al unir su ligando liberando el calcio intracelular).

    ----------------------------

    Aunque no creo que mucha gente haya llegado hasta aquí, si los que lo habéis hecho tenéis preguntas, podéis hacerlas. Intentaré responder lo mejor que sepa / pueda.
    #7 EL CROMOSOMA COMO UNIDAD HEREDITARIA.

    ¿Qué es un cromosoma? ¿Cómo se heredan los genes?

    En el organismo, el DNA se empaqueta (se condensa, para ocupar menos espacio) y almacena en los núcleos de las células en unas estructuras llamadas CROMOSOMAS.



    En la imagen tenemos esquematizada la estructura de un cromosoma, y cómo se presentan en la célula. Como se puede observar el cromosoma es simplemente una enorme agrupación de DNA, enrollado y comprimido al máximo para que ocupe el mínimo espacio en la célula. Esto es importante, pues el genoma humano, totalmente extendido, tiene una LONGITUD TOTAL DE 1.8 METROS, y eso tiene que caber en cada célula del organismo, de modo que es absolutamente necesario que ocupe el mínimo espacio posible.

    Hay que tener en cuenta que el DNA total de un individuo está repartido en los distintos cromosomas que posee, por lo que no está todo “unido”, sino separado en distintas unidades. Esto es importante para entender el proceso de transmisión de los genes desde los progenitores (padres) a los descendientes (hijos), y cómo se generan problemas cuando algo en este proceso de transmisión de la información falla.

    Retomando el tema, de estos cromosomas existe en cada célula del organismo una cantidad que es característica de la especie. Por ejemplo, nosotros los humanos tenemos 46 cromosomas (22 parejas y un par de cromosomas sexuales) en nuestras células diploides, y en las células haploides tenemos 23 cromosomas (la mitad). Ahora definiremos los términos haploide y diploide.



    La imagen superior muestra un cariotipo humano, es decir, la colección de genes que tiene una célula (en el caso de la imagen, una célula diploide). Los cromosomas se ordenan en los cariotipos en diferentes grupos (A, B, C, D, E, F y G) en función de la longitud relativa de sus “brazos”.

    Las células no sexuales (es decir, aquellas que no son espermatozoides y óvulos) tienen dotación doble (repetida) de cromosomas, de modo que tienen una pareja de cada (dotación DIPLOIDE, como en la imagen superior). Cada miembro de esta pareja procede de un progenitor (es decir, uno será de su madre y otro de su padre).

    Como hemos dicho, los cromosomas son simplemente DNA superenrollado, y por lo tanto cada cromosoma tiene necesariamente un conjunto de genes concreto que es característico de la especie. Sin embargo, los cromosomas homólogos ("de la pareja") pueden tener diferentes versiones de cada gen que se conocen como ALELOS. Es decir, los genes pueden tener pequeños cambios en su secuencia de nucleótidos que les haga dar lugar a una proteína ligeramente distinta o directamente afuncional (“inútil”), esto es lo que conocemos como “alelos de un gen”.



    Veámoslo con un ejemplo práctico y sencillo:

    Imaginemos una especie de rosales que dan rosas de color rojo. Un buen día, podando nuestro rosal, nos encontramos una rosa de color blanco. ¿Cómo es esto posible? Lo que puede haber ocurrido es que la enzima (proteína catalítica) crítica para el color de los pétalos haya sufrido una mutación que haya vuelto afuncional, así esa enzima no se genera nunca correctamente y la flor no puede realizar el paso metabólico necesario para conseguir el pigmento de los pétalos. Una versión un poco más compleja que esta es lo que ocurre en la mayoría de los casos de albinismo en el reino animal.

    En este caso, tendríamos un gen (el gen que genera la enzima capaz de pigmentar la flor) y dos alelos (posibilidades para ese gen), el alelo “normal”, capaz de generar la enzima que pigmenta de rojo los pétalos, y el alelo “mutante” que da lugar a una enzima aberrante incapaz de llevar a cabo su función. La cosa podría complicarse más con más alelos, por ejemplo, podría haber una versión alélica que fuera menos eficiente que el “alelo normal”, y que por ello pigmentara la flor de rosa en lugar de rojo, porque no es capaz de generar tanto pigmento como el “alelo normal”. Así tendríamos un gen (que genera la enzima pigmentadora) y tres alelos, el normal (pigmenta de rojo), el menos eficiente (pigmenta de rosa) y el mutante (afuncional, no pigmenta).



    Continuando con el tema anterior, en los gametos (células sexuales) sólo existe UNA COPIA del cada cromosoma (dotación HAPLOIDE). Esta copia viene por BARAJADO ALEATORIO de las dos que tenía la célula (diploide) de la que se originó el gameto durante la GAMETOGÉNESIS (hablaré de la gametogénesis en otro artículo).

    Durante la fecundación, cada una de las células progenitoras (óvulo y espermatozoide) aporta pues UNA COPIA de cada uno de los cromosomas homólogos. Como se puede ver en la imagen. Se ha simplificado imaginando una especie que tiene únicamente dos cromosomas totales en dotación haploide (recordad, los humanos tenemos 23). El óvulo aportaría un “cromosoma 1” y un “cromosoma 2” y el espermatozoide otro “cromosoma 1” y otro “cromosoma 2”. El cigoto resultante sería una célula DIPLOIDE, con dos cromosomas 1 y dos cromosomas 2 homólogos, y cada homólogo procedería pues de un progenitor.



    El organismo tiene pues DOS COPIAS HOMÓLOGAS de cada secuencia de DNA, y tiene sus genes POR DUPLICADO. Esto permite que cada gen tenga DOS VERSIONES, una que viene del padre y otra que viene de la madre.

    En el organismo cada gen se expresa en un momento y lugar (del cuerpo) concreto dando lugar a una proteína (como veíamos antes en #0). La presencia de estas proteínas puede determinar el estado de un carácter. Hay caracteres raros, que llamamos "monogénicos" o "mendelianos" cuyo estado está condicionado por la presencia del alelo de una única proteína (en el ejemplo de la rosa se proponía así). Aunque en general, como la definición de un carácter es arbitraria, el estado de ese carácter suele estar influenciado por multitud de factores genéticos (alelos de hasta cientos de genes) y de factores ambientales (desarrollo...), un ejemplo de esto es la displasia de cadera. No existe un “gen de la displasia de cadera”, si no que la patología está influenciada por varios genes que determinan la forma del acetábulo y de la cabeza del fémur, y por factores ambientales tales como el desarrollo del perro durante su juventud (si fuerza la extremidad puede agravar la displasia), la obesidad (el peso sobre la cadera agrava las patologías de cadera)… etc.

    Es importante quedarse con la idea de que NO HEREDAMOS GENES de nuestros padres sino CROMOSOMAS, y cada cromosoma tiene un conjunto concreto de genes. Así es como sucede que hay enfermedades que se relacionan con ciertas características fenotípicas, porque los genes que las influencian se encuentran en el mismo cromosoma que los genes que dan esas características fenotípicas.

    -------------------------------

    Otro capitulillo-tostón para el que quiera leer. Si tenéis preguntas ya sabéis...

    #6 #5 #3 #1
  • sarik

    Agregar como amigo

    Registrado: 07/04/2012
    Posts: 569

    #9

    16/05/2012, 17:27

    #0 En este tema iré escribiendo pequeños artículos de genética básica, para el que esté interesado. Seguramente escriba más de uno, por lo que os recomiendo que no leáis exclusivamente el primer post del tema si acaba teniendo muchas hojas, y que busquéis si hay más información en el futuro.

    El texto es de mi puño y letra a no ser que especifique lo contrario. Las imágenes son todas de Internet.

    --------------------------------------------------------


    LOS GENES NO CODIFICAN CARACTERES, CODIFICAN PROTEÍNAS.

    ¿Por qué es importante entender esto?

    Mucha gente tiene la tendencia a pensar que un gen da lugar de forma invariable a un carácter. Es decir, que existe un gen de los ojos azules, un gen del pelo rubio, un gen de los brazos largos, un gen de la piel oscura… etc.

    Esto es absoluta y totalmente erróneo, y deriva del escasísimo conocimiento genético que tiene la población de hoy en día, cuyos conocimientos se derivan de la genética mendeliana donde se vieron estos sucesos. Los experimentos de Mendel explican la parte más sencilla de la genética, pero se quedan cortos (cortísimos) para hablar de temas más serios, como las enfermedades hereditarias de los perros, por ejemplo.

    Por eso es importante que quede BIEN CLARO que los genes NO DAN LUGAR a caracteres concretos, sino a proteínas. Y es la interacción de las proteínas entre ellas (o la carencia de esta interacción, en algunos casos) lo que da lugar a la mayoría de los caracteres genéticos.

    Para el que ande pez, un carácter es cualquier cosa que os queráis proponer. Desde el color de ojos, pasando por la altura de una persona, hasta la longitud del hueso de la mandíbula inferior o el color de la planta del pie. Todo eso está determinado, en parte por su BACKGROUND genético y en parte de forma ambiental (es decir, por el desarrollo embrionario, entre otros).



    Entonces, ¿qué es un gen molecularmente hablando?

    Una mirada hacia atrás: el DNA, ese gran desconocido.

    Si atendemos al DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR, propuesto por Watson y Crick a raíz de su descubrimiento de la estructura molecular del DNA (estudios por los que obtendrían el premio Nobel) se propone un flujo unidireccional de la información genética (que hoy día se ha demostrado que tiene excepciones pero que nos sirve para lo que queremos explicar).

    La información genética de un individuo está "guardada" en su DNA. El DNA es simplemente una molécula en forma de doble hélice formada por unidades que se emparejan con la otra hebra de manera concreta. Tenemos 4 unidades (nucleótidos) distintos, Adenina (A), Guanina (G), Citosina (C) y Timina (T). Adenina siempre empareja con Timina a través de dos puentes de hidrógeno (un tipo de enlace químico) y Citosina lo hace con Guanina a través de tres puentes de hidrógeno. Gracias a esto se forma una estructura de doble hélice levógira (que gira a izquierdas) en la que se concentra toda la información genética de un individuo.



    ¿Cómo es eso posible?

    Es sencillo, y es la base del DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR. La información contenida en el DNA está en forma de CÓDIGO, de modo que cada una de las dos hebras que forman la molécula de DNA tiene un código "de letras" formado por sus nucleótidos. Por ejemplo, el código de una hebra de DNA puede ser:

    AAAGCGAGTAGTGGCCATGAC

    Los sistemas celulares saben interpretar este código y producir otras moléculas a partir de él, así es que a partir del DNA por un proceso que se conoce como TRANSCRIPCIÓN, y a través de unas enzimas (proteínas catalíticas) concretas obtenemos los distintos tipos de RNA (ribosómico, de transferencia y mensajero).


    ¿Interpretamos el código? Fabricando proteínas.

    Dejaremos de lado dos de los tipos de RNA y nos interesaremos por el RNA mensajero, pues es el que principalmente dará lugar a las proteínas de los organismos.

    Así es que a través del proceso de TRANSCRIPCIÓN el ejemplo de código anterior puede TRANSCRIBIRSE a RNA. El RNA se diferencia del DNA básicamente en un sustituyente (una ramificación) de la ribosa que forma el nucleótido y en que no existe el nucleótido Timina, en su lugar existe el Uracilo (U), que empareja con la Adenina igual que la Timina (con dos puentes de hidrógeno). Así si nosotros fuéramos una enzima (concretamente, una RNA polimerasa), TRANSCRIBIRÍAMOS el código de la hebra anterior a RNA mensajero así:

    UUUCGCUCACCGGUACUG

    Simplemente:
    Donde hay A ponemos U (pues la adenina empareja con uracilo).
    Donde hay T ponemos A (pues la timina empareja con la adenina).
    Donde hay G ponemos C (pues la guanina empareja con la citosina).
    Donde hay C ponemos G (pues la citosina empareja con la guanina).



    En la imagen se esquematiza el proceso de la transcripción. Las líneas azules representan las dos cadenas del DNA, que se mantienen superenrrolladas en condiciones normales. Durante la transcripción, mediante otras enzimas y un proceso molecular complejo se libera la tensión en la zona de interés (donde está el gen que queremos transcribir) para garantizar el acceso de la RNA polimerasa (pelota azul). La línea naranja representa el RNA mensajero que la RNA polimerasa se está encargando de generar. Como se puede observar, sólo una cadena del DNA se utiliza para la transcripción (cadena molde), la otra no se utiliza (cadena inactiva). El uso de una u otra, y en una dirección u otra dependerá de qué gen (o genes) esté la célula interesada en transcribir.

    Continuemos, ya tenemos el RNA mensajero… ¿De dónde sacamos la proteína?

    El proceso molecular de transmisión de la información génica no concluye con la transcripción, el RNA mensajero tiene que ser leído por la maquinaria celular para producir otras moléculas: las PROTEÍNAS. Este proceso se denomina TRADUCCIÓN, y se efectúa a través de la actuación de la maquinaria ribosomal de la célula (es decir, de los orgánulos celulares conocidos como “ribosomas”).



    La imagen muestra la estructura de un ribosoma. Está formado por dos subunidades que se conocen como “subunidad grande” y “subunidad pequeña”. Durante el proceso de traducción el ribosoma “lee” la hebra de RNA mensajero formada durante la traducción y construye una cadena peptídico a partir de ella, que dará lugar a una proteína.

    Así, el RNA mensajero es leído y se produce la proteína mediante el uso de los aminoácidos, unas moléculas peptídicas que producimos en el cuerpo o ingerimos con la dieta (aminoácidos esenciales). Así, mediante la maquinaria celular un RNA mensajero es convertido a proteína mediante la interpretación del código genético (que es universal):



    La imagen superior esquematiza el código genético. Este se lee en “codones”, o lo que es lo mismo “en grupos de tres nucleótidos”. Como se ve en la imagen, los distintos codones dan lugar a un aminoácido concreto. Por ejemplo: UUU y UUC codifican el aminoácido Fen (fenilalanina).

    Siguiendo el ejemplo anterior, nuestra hebra era:

    UUUCGCUCACCGGUACUG

    La separamos en grupos de tres codones:

    UUU // CGC // UCA // CCG // GUA // CUG

    Y miramos qué aminoácido codifican con el código genético. Obteniendo:

    Fen – Arg – Ser – Pro – Val – Leu

    Los aminoácidos que aparecen, por si no conocéis la abreviatura son: fenialanina (Fen), arginina (Arg), serina (Ser), prolina (Pro), valina (Val) y leucina (Leu).

    Con esto la célula tendría su PROTEÍNA CONSTRUIDA (interpretada desde su código genético), que mediante los mecanismos apropiados (con ayuda de otras proteínas llamadas chaperonas) se plegaría para tener la estructura correcta y ejercer su función en la célula (por ejemplo, puede ser una proteína que forme un canal de calcio dimérico que se abra al unir su ligando liberando el calcio intracelular).

    ----------------------------

    Aunque no creo que mucha gente haya llegado hasta aquí, si los que lo habéis hecho tenéis preguntas, podéis hacerlas. Intentaré responder lo mejor que sepa / pueda.
    una pregunta antes de suir leyendo,no me importa quedar como ignorante porque no tengo ni idea de genética,pero las proteinas las fabrica el organismo?no es de los alimentos?otra cosa es igual enfermedad genetica que congénita?
< 1 2 3 4 ...>

Responder este tema

Tienes que estar registrado para participar en esta sección.
- Si ya eres miembro de mundoAnimalia, identifícate
- Si aún no te has registrado, Regístrate gratis



Crear nuevo tema

Miembros más activos

  • isabelmb

    114

    En mundoAnimalia desde 11/09/2010

  • ukyo

    111

    En mundoAnimalia desde 04/01/2011

  • sarik

    66

    En mundoAnimalia desde 07/04/2012

  • dalmata101

    49

    En mundoAnimalia desde 26/09/2010

  • uka46

    45

    En mundoAnimalia desde 05/03/2012

Insertar imagen

Selecciona la parte de la imagen que deseas para crear la miniatura:

Así quedará tu foto en los listados de MundoAnimalia:

Identifícate para acceder a tu cuenta

Nunca publicaremos en tu muro

Debes introducir tu usuario y tu contraseña

¿Has olvidado tu contraseña?
¿No tienes cuenta? Regístrate

Este sitio web utiliza cookies propias y de terceros para asegurarte una mejor experiencia. Al usar nuestro servicio, aceptas el uso de las mismas. Pulsa para ver más información sobre las cookies.

Close¿Tienes mascotas?

¡Comparte sus fotos!

Regístrate ya